Stem-loop sequence ocu-mir-18b

AccessionMI0039227 (change log)
DescriptionOryctolagus cuniculus miR-18b stem-loop
Stem-loop
   ----u    u    c   u     --uag       
5'      aagg gcau uag gcagu     ugaagc 
        |||| |||| ||| |||||     ||||| a
3'      uucc cgua auc cguca     gcuuca 
   cgguc    c    a   c     ucuaa       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000811.1: 108518869-108518933 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-18b
ocu-mir-106aCM000811.1: 108519035-108519093 [-]
ocu-mir-18bCM000811.1: 108518869-108518933 [-]
ocu-mir-20bCM000811.1: 108518633-108518692 [-]
ocu-mir-19b-2CM000811.1: 108518503-108518568 [-]
ocu-mir-92a-2CM000811.1: 108518367-108518428 [-]
ocu-mir-363CM000811.1: 108518210-108518274 [-]
Database links

Mature sequence ocu-miR-18b-5p

Accession MIMAT0048113
Sequence

1 - 

uaaggugcaucuagugcaguuag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-18b-3p

Accession MIMAT0048114
Sequence

44 - 

ugcccuaaaugccccuucuggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).