Stem-loop sequence ocu-mir-18a

AccessionMI0039226 (change log)
DescriptionOryctolagus cuniculus miR-18a stem-loop
Stem-loop
   ----u    u   uc   u    a   -  aa u 
5'      aagg gca  uag gcag uag ug  g a
        |||| |||  ||| |||| ||| ||  | g
3'      uucc cgu  auc cguc auc ac  u a
   cgguc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000797.1: 93067839-93067903 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-18a
ocu-mir-17CM000797.1: 93067701-93067759 [+]
ocu-mir-18aCM000797.1: 93067839-93067903 [+]
ocu-mir-19aCM000797.1: 93067987-93068044 [+]
ocu-mir-20aCM000797.1: 93068174-93068232 [+]
ocu-mir-19b-1CM000797.1: 93068307-93068367 [+]
ocu-mir-92a-1CM000797.1: 93068424-93068482 [+]
Database links

Mature sequence ocu-miR-18a-5p

Accession MIMAT0048111
Sequence

1 - 

uaaggugcaucuagugcagauag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-18a-3p

Accession MIMAT0048112
Sequence

42 - 

acugcccuaagugcuccuucuggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).