Stem-loop sequence ocu-mir-7a

AccessionMI0039216 (change log)
DescriptionOryctolagus cuniculus miR-7a stem-loop
Literature search

1 open access papers mention ocu-mir-7a
(2 sentences)

Stem-loop
   --   a     a       u      --     a 
5'   ugg agacu gugauuu guuguu  uuuag u
     ||| ||||| ||||||| ||||||  |||||  
3'   acc ucuga cacuaaa caacag  aaauc a
   au   g     -       -      cu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018728.1: 1064317-1064380 [-]
intergenic
Database links

Mature sequence ocu-miR-7a-5p

Accession MIMAT0048093
Sequence

1 - 

uggaagacuagugauuuuguuguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-7a-3p

Accession MIMAT0048094
Sequence

43 - 

caacaaaucacagucugccaua

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).