Stem-loop sequence ocu-mir-1-2

AccessionMI0039215 (change log)
DescriptionOryctolagus cuniculus miR-1-2 stem-loop
Literature search

2 open access papers mention ocu-mir-1-2
(74 sentences)

Stem-loop
   --                ac     ugaaca 
5'   acauacuucuuuaugu  ccaua      u
     ||||||||||||||||  |||||       
3'   uguaugaagaaaugua  gguau      a
   ua                -a     cguaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000798.1: 63183544-63183604 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-1-2
ocu-mir-1-2CM000798.1: 63183544-63183604 [-]
ocu-mir-133aCM000798.1: 63180526-63180585 [-]
Database links

Mature sequence ocu-miR-1-5p

Accession MIMAT0048091
Sequence

1 - 

acauacuucuuuauguacccaua

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-miR-1-3p

Accession MIMAT0048092
Sequence

40 - 

uggaauguaaagaaguauguau

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).