Stem-loop sequence ocu-let-7i

AccessionMI0039214 (change log)
DescriptionOryctolagus cuniculus let-7i stem-loop
Literature search

2 open access papers mention ocu-let-7i
(10 sentences)

Stem-loop
   --u                 u   --------  u     ugu 
5'    gagguaguaguuugugc guu        gg cgggu   g
      ||||||||||||||||| |||        || |||||   a
3'    uuccgucaucgaacgcg caa        uc gcccg   c
   ucg                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000793.1: 41563454-41563531 [+]
intergenic
Database links

Mature sequence ocu-let-7i-5p

Accession MIMAT0048089
Sequence

1 - 

ugagguaguaguuugugcuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-let-7i-3p

Accession MIMAT0048090
Sequence

57 - 

cugcgcaagcuacugccuugcu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).