Stem-loop sequence ocu-let-7f-1

AccessionMI0039211 (change log)
DescriptionOryctolagus cuniculus let-7f-1 stem-loop
Literature search

2 open access papers mention ocu-let-7f-1
(10 sentences)

   --u                       ---------       u 
5'    gagguaguagauuguauaguugu         gggguag g
      |||||||||||||||||||||||         ||||||| a
3'    uuccguuaucuaacauaucaaua         ucccauu u
   ccc                       gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000790.1: 71564253-71564330 [+]
Clustered miRNAs
< 10kb from ocu-let-7f-1
ocu-let-7a-1CM000790.1: 71563893-71563965 [+]
ocu-let-7f-1CM000790.1: 71564253-71564330 [+]
ocu-let-7dCM000790.1: 71566522-71566597 [+]
Database links

Mature sequence ocu-let-7f-5p

Accession MIMAT0048084

1 - 


 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-let-7f-3p

Accession MIMAT0048085

57 - 


 - 78

Get sequence
Evidence experimental; Illumina [1]


PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).