Stem-loop sequence ocu-let-7b

AccessionMI0039208 (change log)
DescriptionOryctolagus cuniculus let-7b stem-loop
Literature search

2 open access papers mention ocu-let-7b
(10 sentences)

Stem-loop
   --u                     -  -----    ca   g 
5'    gagguaguagguugugugguu uc     aggg  gcg u
      ||||||||||||||||||||| ||     ||||  |||  
3'    uuccgucauccgacauaucaa ag     uccc  cgc g
   ccc                     u  acgac    --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
GL018928.1: 74189-74264 [+]
intergenic
Clustered miRNAs
< 10kb from ocu-let-7b
ocu-let-7a-3GL018928.1: 73632-73701 [+]
ocu-let-7bGL018928.1: 74189-74264 [+]
Database links

Mature sequence ocu-let-7b-5p

Accession MIMAT0048078
Sequence

1 - 

ugagguaguagguugugugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ocu-let-7b-3p

Accession MIMAT0048079
Sequence

55 - 

cuauacagccuacugccuuccc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).