Stem-loop sequence dno-mir-3085

AccessionMI0039198 (change log)
DescriptionDasypus novemcinctus miR-3085 stem-loop
Stem-loop
   ---a  u    uucc   -      g   ug   u 
5'     gg gcca    gag ggccag agu  gau a
       || ||||    ||| |||||| |||  ||| u
3'     cc cggu    cuc ucgguc uca  cug g
   cucc  -    ----   g      -   --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH567359.1: 2867179-2867239 [-]
intergenic
Database links

Mature sequence dno-miR-3085-5p

Accession MIMAT0048061
Sequence

1 - 

aggugccauuccgagggccaggagu

 - 25

Get sequence
Evidence not experimental

Mature sequence dno-miR-3085-3p

Accession MIMAT0048062
Sequence

41 - 

ucuggcugcucuggcccccuc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).