Stem-loop sequence dno-mir-653

AccessionMI0039161 (change log)
DescriptionDasypus novemcinctus miR-653 stem-loop
Literature search

1 open access papers mention dno-mir-653
(1 sentences)

Stem-loop
   --           u   ug      uaaguc 
5'   uguugaaacaa cuc  gugagc      c
     ||||||||||| |||  ||||||      c
3'   acaacuuuguu gag  cacuug      a
   uc           u   gu      uacuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH574710.1: 688203-688265 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-653
dno-mir-489JH574710.1: 687595-687653 [+]
dno-mir-653JH574710.1: 688203-688265 [+]
Database links

Mature sequence dno-miR-653-5p

Accession MIMAT0047988
Sequence

1 - 

uguugaaacaaucucuggugagc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-653-3p

Accession MIMAT0047989
Sequence

41 - 

ucacuggaguuuguuucaacacu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).