Stem-loop sequence dno-mir-455

AccessionMI0039119 (change log)
DescriptionDasypus novemcinctus miR-455 stem-loop
Stem-loop
   --         u      a   c   gaa 
5'   uaugugccu uggacu cau gug   g
     ||||||||| |||||| ||| |||    
3'   auauacggg gccuga gua cac   c
   ac         u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570314.1: 1028610-1028667 [+]
intergenic
Database links

Mature sequence dno-miR-455-5p

Accession MIMAT0047906
Sequence

1 - 

uaugugccuuuggacuacaucg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-455-3p

Accession MIMAT0047907
Sequence

37 - 

augcaguccgugggcauauaca

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).