Stem-loop sequence dno-mir-383

AccessionMI0039099 (change log)
DescriptionDasypus novemcinctus miR-383 stem-loop
Stem-loop
   --a      aa    a        --    gu 
5'    gaucag  ggug uuguggcu  uugg  g
      ||||||  |||| ||||||||  ||||  g
3'    cugguc  ucac gacaccga  aauc  a
   aga      cg    -        cu    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH564670.1: 1798893-1798954 [-]
intergenic
Database links

Mature sequence dno-miR-383-5p

Accession MIMAT0047868
Sequence

1 - 

agaucagaaggugauuguggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-383-3p

Accession MIMAT0047869
Sequence

42 - 

ccacagcacugccuggucaga

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).