Stem-loop sequence dno-mir-372

AccessionMI0039087 (change log)
DescriptionDasypus novemcinctus miR-372 stem-loop
Stem-loop
   --c       g   a      c    gcua 
5'    cucaaau ugg ggcacu uucu    u
      ||||||| ||| |||||| ||||    c
3'    ggguuua acc ucguga aagg    u
   ugu       a   g      -    uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570335.1: 104769-104828 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-372
dno-mir-371JH570335.1: 104581-104641 [+]
dno-mir-372JH570335.1: 104769-104828 [+]
Database links

Mature sequence dno-miR-372-5p

Accession MIMAT0047844
Sequence

1 - 

ccucaaauguggaggcacucuucu

 - 24

Get sequence
Evidence not experimental

Mature sequence dno-miR-372-3p

Accession MIMAT0047845
Sequence

38 - 

aaagugcugccaaauuugggugu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).