Stem-loop sequence dno-mir-302d

AccessionMI0039063 (change log)
DescriptionDasypus novemcinctus miR-302d stem-loop
Stem-loop
   --    u                cu     c 
5'   acuu aacauggaagcacuug  gugag u
     |||| ||||||||||||||||  |||||  
3'   ugag uuguaccuucgugaau  uauuu a
   ug    u                --     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH580080.1: 1519185-1519244 [-]
intergenic
Clustered miRNAs
< 10kb from dno-mir-302d
dno-mir-302bJH580080.1: 1519661-1519717 [-]
dno-mir-302cJH580080.1: 1519526-1519585 [-]
dno-mir-302aJH580080.1: 1519344-1519404 [-]
dno-mir-302dJH580080.1: 1519185-1519244 [-]
dno-mir-367JH580080.1: 1519066-1519125 [-]
Database links

Mature sequence dno-miR-302d-5p

Accession MIMAT0047797
Sequence

1 - 

acuuuaacauggaagcacuugcu

 - 23

Get sequence
Evidence not experimental

Mature sequence dno-miR-302d-3p

Accession MIMAT0047798
Sequence

38 - 

uaagugcuuccauguuugagugu

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).