Stem-loop sequence dno-mir-302c

AccessionMI0039062 (change log)
DescriptionDasypus novemcinctus miR-302c stem-loop
Stem-loop
   --   uu             c    -a  u 
5'   gcu  aacauggggguac ugcu  ug a
     |||  ||||||||||||| ||||  || a
3'   uga  uuguaccuucgug auga  ac a
   gg   cu             a    aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH580080.1: 1519526-1519585 [-]
intergenic
Clustered miRNAs
< 10kb from dno-mir-302c
dno-mir-302bJH580080.1: 1519661-1519717 [-]
dno-mir-302cJH580080.1: 1519526-1519585 [-]
dno-mir-302aJH580080.1: 1519344-1519404 [-]
dno-mir-302dJH580080.1: 1519185-1519244 [-]
dno-mir-367JH580080.1: 1519066-1519125 [-]
Database links

Mature sequence dno-miR-302c-5p

Accession MIMAT0047795
Sequence

1 - 

gcuuuaacauggggguaccugcu

 - 23

Get sequence
Evidence not experimental

Mature sequence dno-miR-302c-3p

Accession MIMAT0047796
Sequence

38 - 

uaagugcuuccauguuucagugg

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).