Stem-loop sequence dno-mir-302b

AccessionMI0039061 (change log)
DescriptionDasypus novemcinctus miR-302b stem-loop
Stem-loop
   --   uu               u  guu 
5'   acu  aacauggagguacuu cu   u
     |||  ||||||||||||||| ||   c
3'   uga  uuguaccuucgugaa ga   u
   ga   uu               u  aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH580080.1: 1519661-1519717 [-]
intergenic
Clustered miRNAs
< 10kb from dno-mir-302b
dno-mir-302bJH580080.1: 1519661-1519717 [-]
dno-mir-302cJH580080.1: 1519526-1519585 [-]
dno-mir-302aJH580080.1: 1519344-1519404 [-]
dno-mir-302dJH580080.1: 1519185-1519244 [-]
dno-mir-367JH580080.1: 1519066-1519125 [-]
Database links

Mature sequence dno-miR-302b-5p

Accession MIMAT0047793
Sequence

1 - 

acuuuaacauggagguacuuucu

 - 23

Get sequence
Evidence not experimental

Mature sequence dno-miR-302b-3p

Accession MIMAT0047794
Sequence

35 - 

uaagugcuuccauguuuuaguag

 - 57

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).