Stem-loop sequence dno-mir-219a

AccessionMI0039050 (change log)
DescriptionDasypus novemcinctus miR-219a stem-loop
Stem-loop
   --u   u     a  g         a   ucu 
5'    gau gucca ac caauucucg guc   g
      ||| ||||| || ||||||||| |||   g
3'    cug caggu ug guugagagc cgg   a
   gcc   -     c  a         -   ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH578991.1: 782596-782658 [-]
intergenic
Database links

Mature sequence dno-miR-219a-5p

Accession MIMAT0047771
Sequence

1 - 

ugauuguccaaacgcaauucucg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-219a-3p

Accession MIMAT0047772
Sequence

42 - 

agaguugagucuggacgucccg

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).