Stem-loop sequence dno-mir-216a

AccessionMI0039045 (change log)
DescriptionDasypus novemcinctus miR-216a stem-loop
Stem-loop
   --         cu   a        ac   c 
5'   uaaucucag  ggc acugugag  guu a
     |||||||||  ||| ||||||||  ||| u
3'   auuaggguc  cug ugacacuc  uaa a
   gu         -u   g        cu   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH567881.1: 176266-176327 [-]
intergenic
Clustered miRNAs
< 10kb from dno-mir-216a
dno-mir-216aJH567881.1: 176266-176327 [-]
dno-mir-217JH567881.1: 170442-170502 [-]
Database links

Mature sequence dno-miR-216a-5p

Accession MIMAT0047762
Sequence

1 - 

uaaucucagcuggcaacugugag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-216a-3p

Accession MIMAT0047763
Sequence

41 - 

cacaguggucucugggauuaug

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).