Stem-loop sequence dno-mir-215

AccessionMI0039044 (change log)
DescriptionDasypus novemcinctus miR-215 stem-loop
Stem-loop
   --a  a     -   u          uaua 
5'    ug ccuau gaa ugacagacaa    a
      || ||||| ||| ||||||||||    c
3'    ac ggaug cuu acugucuguu    u
   uua  c     u   u          ugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH579496.1: 2455274-2455333 [-]
intergenic
Database links

Mature sequence dno-miR-215-5p

Accession MIMAT0047760
Sequence

1 - 

augaccuaugaauugacagaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-215-3p

Accession MIMAT0047761
Sequence

38 - 

ucugucauuucuguaggccaauu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).