Stem-loop sequence dno-mir-210

AccessionMI0039041 (change log)
DescriptionDasypus novemcinctus miR-210 stem-loop
Stem-loop
   --    c   cc   -      c  c -     
5'   agcc cug  cac cgcaca ug g cugc 
     |||| |||  ||| |||||| || | ||| u
3'   ucgg gac  gug gcgugu ac c ggcc 
   ag    c   -a   u      c  c a     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
AAGV03299361.1: 67-126 [-]
intergenic
Database links

Mature sequence dno-miR-210-5p

Accession MIMAT0047754
Sequence

1 - 

agccccugcccaccgcacacug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-210-3p

Accession MIMAT0047755
Sequence

39 - 

cugugcgugugacagcggcuga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).