Stem-loop sequence dno-mir-206

AccessionMI0039038 (change log)
DescriptionDasypus novemcinctus miR-206 stem-loop
Stem-loop
   --                cc     c g uu 
5'   acaugcuucuuuauau  ccaua g a  a
     ||||||||||||||||  ||||| | |   
3'   ugugugaaggaaugua  gguau c u  c
   gg                -a     - g ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH569061.1: 719151-719210 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-206
dno-mir-206JH569061.1: 719151-719210 [+]
dno-mir-133bJH569061.1: 724912-724970 [+]
Database links

Mature sequence dno-miR-206-5p

Accession MIMAT0047748
Sequence

1 - 

acaugcuucuuuauauccccaua

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-206-3p

Accession MIMAT0047749
Sequence

39 - 

uggaauguaaggaagugugugg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).