Stem-loop sequence dno-mir-205

AccessionMI0039037 (change log)
DescriptionDasypus novemcinctus miR-205 stem-loop
Stem-loop
   --uc           c        ucuca 
5'     cuucauuccac ggagucug     u
       ||||||||||| ||||||||     a
3'     gaagugaggug cuuuagac     c
   acuu           a        caacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570311.1: 3472382-3472440 [+]
intergenic
Database links

Mature sequence dno-miR-205-5p

Accession MIMAT0047746
Sequence

1 - 

uccuucauuccaccggagucugu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-205-3p

Accession MIMAT0047747
Sequence

38 - 

gauuucaguggagugaaguuca

 - 59

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).