Stem-loop sequence dno-mir-193b

AccessionMI0039025 (change log)
DescriptionDasypus novemcinctus miR-193b stem-loop
Stem-loop
   --    gu    a    g  a  ag uuua 
5'   cggg  uuug gggc ag ug  u    u
     ||||  |||| |||| || ||  |     
3'   gccc  aaac cccg uc ac  a    g
   uc    ug    a    g  a  cu uuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH569587.1: 2251302-2251361 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-193b
dno-mir-193bJH569587.1: 2251302-2251361 [+]
dno-mir-365-1JH569587.1: 2255954-2256015 [+]
Database links

Mature sequence dno-miR-193b-5p

Accession MIMAT0047723
Sequence

1 - 

cgggguuuugagggcgagauga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-193b-3p

Accession MIMAT0047724
Sequence

39 - 

aacuggcccacaaagucccgcu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).