Stem-loop sequence dno-mir-182

AccessionMI0039013 (change log)
DescriptionDasypus novemcinctus miR-182 stem-loop
Literature search

1 open access papers mention dno-mir-182
(1 sentences)

Stem-loop
   --u       u -g      uca      ugaggu 
5'    uuggcaa g  uagaac   cacugg      a
      ||||||| |  ||||||   ||||||       
3'    aaccguu c  aucuug   guggcc      a
   auc       - ag      ---      uagggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH568910.1: 1124861-1124925 [-]
intergenic
Clustered miRNAs
< 10kb from dno-mir-182
dno-mir-183JH568910.1: 1129147-1129208 [-]
dno-mir-96JH568910.1: 1128922-1128985 [-]
dno-mir-182JH568910.1: 1124861-1124925 [-]
Database links

Mature sequence dno-miR-182-5p

Accession MIMAT0047699
Sequence

1 - 

uuuggcaaugguagaacucacacu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-182-3p

Accession MIMAT0047700
Sequence

45 - 

ugguucuagacuugccaacua

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).