Stem-loop sequence dno-mir-144

AccessionMI0038993 (change log)
DescriptionDasypus novemcinctus miR-144 stem-loop
Stem-loop
   -  -        a         a  uug a 
5'  gg auaucauc uauacugua gu   c a
    || |||||||| ||||||||| ||   | u
3'  uc uguaguag auaugacau ca   g g
   a  a        -         -  -ua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH563368.1: 9611-9668 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-144
dno-mir-144JH563368.1: 9611-9668 [+]
dno-mir-451JH563368.1: 9790-9852 [+]
Database links

Mature sequence dno-miR-144-5p

Accession MIMAT0047661
Sequence

1 - 

ggauaucaucauauacuguaagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-144-3p

Accession MIMAT0047662
Sequence

38 - 

uacaguauagaugauguacua

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).