Stem-loop sequence dno-mir-142

AccessionMI0038991 (change log)
DescriptionDasypus novemcinctus miR-142 stem-loop
Stem-loop
   --          a         uaa ag a 
5'   cauaaaguag aagcacuac   c  c c
     |||||||||| |||||||||   |  |  
3'   guauuucauc uuugugaug   g  g u
   ag          c         -ug ga g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH568468.1: 518900-518958 [-]
intergenic
Database links

Mature sequence dno-miR-142-5p

Accession MIMAT0047657
Sequence

1 - 

cauaaaguagaaagcacuacu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-142-3p

Accession MIMAT0047658
Sequence

39 - 

uaguguuuccuacuuuaugga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).