Stem-loop sequence dno-mir-92a-1

AccessionMI0038947 (change log)
DescriptionDasypus novemcinctus miR-92a-1 stem-loop
Stem-loop
   --          c   u        --   u 
5'   agguugggau agu gcaaugcu  gug u
     |||||||||| ||| ||||||||  |||  
3'   uccggcccug uca cguuaugg  uac u
   ug          u   -        uu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570327.1: 93045-93103 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-92a-1
dno-mir-17JH570327.1: 92325-92383 [+]
dno-mir-18aJH570327.1: 92464-92528 [+]
dno-mir-19aJH570327.1: 92615-92672 [+]
dno-mir-20aJH570327.1: 92793-92851 [+]
dno-mir-19b-1JH570327.1: 92928-92988 [+]
dno-mir-92a-1JH570327.1: 93045-93103 [+]
Database links

Mature sequence dno-miR-92a-5p

Accession MIMAT0047581
Sequence

1 - 

agguugggaucaguugcaaugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-92a-3p

Accession MIMAT0047582
Sequence

38 - 

uauugcacuugucccggccugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).