Stem-loop sequence dno-mir-30a

AccessionMI0038934 (change log)
DescriptionDasypus novemcinctus miR-30a stem-loop
Literature search

1 open access papers mention dno-mir-30a
(1 sentences)

Stem-loop
   --           uc           gugaag 
5'   uguaaacaucc  gacuggaagcu      c
     |||||||||||  |||||||||||      u
3'   acguuuguagg  cugacuuucgg      g
   cg           --           guagac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH582191.1: 2112177-2112239 [-]
intergenic
Database links

Mature sequence dno-miR-30a-5p

Accession MIMAT0047556
Sequence

1 - 

uguaaacauccucgacuggaagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-30a-3p

Accession MIMAT0047557
Sequence

42 - 

cuuucagucggauguuugcagc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).