Stem-loop sequence dno-mir-20a

AccessionMI0038915 (change log)
DescriptionDasypus novemcinctus miR-20a stem-loop
Literature search

1 open access papers mention dno-mir-20a
(5 sentences)

Stem-loop
   ---ua                 g   -  uu 
5'      aagugcuuauagugcag uag ug  u
        ||||||||||||||||| ||| ||   
3'      uucacgaguauuacguc auc au  a
   ugaaa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570327.1: 92793-92851 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-20a
dno-mir-17JH570327.1: 92325-92383 [+]
dno-mir-18aJH570327.1: 92464-92528 [+]
dno-mir-19aJH570327.1: 92615-92672 [+]
dno-mir-20aJH570327.1: 92793-92851 [+]
dno-mir-19b-1JH570327.1: 92928-92988 [+]
dno-mir-92a-1JH570327.1: 93045-93103 [+]
Database links

Mature sequence dno-miR-20a-5p

Accession MIMAT0047520
Sequence

1 - 

uaaagugcuuauagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-20a-3p

Accession MIMAT0047521
Sequence

37 - 

acugcauuaugagcacuuaaagu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).