Stem-loop sequence dno-mir-19b-1

AccessionMI0038913 (change log)
DescriptionDasypus novemcinctus miR-19b-1 stem-loop
Literature search

1 open access papers mention dno-mir-19b-1
(6 sentences)

Stem-loop
   --         -  -      uc    ugugu 
5'   aguuuugca gg uuugca  cagc     g
     ||||||||| || ||||||  ||||     a
3'   ucaaaacgu cc aaacgu  gucg     u
   ag         a  u      --    ucuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570327.1: 92928-92988 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-19b-1
dno-mir-17JH570327.1: 92325-92383 [+]
dno-mir-18aJH570327.1: 92464-92528 [+]
dno-mir-19aJH570327.1: 92615-92672 [+]
dno-mir-20aJH570327.1: 92793-92851 [+]
dno-mir-19b-1JH570327.1: 92928-92988 [+]
dno-mir-92a-1JH570327.1: 93045-93103 [+]
Database links

Mature sequence dno-miR-19b-5p

Accession MIMAT0047517
Sequence

1 - 

aguuuugcagguuugcauccagc

 - 23

Get sequence
Evidence not experimental

Mature sequence dno-miR-19b-3p

Accession MIMAT0047518
Sequence

39 - 

ugugcaaauccaugcaaaacuga

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).