Stem-loop sequence dno-mir-19a

AccessionMI0038912 (change log)
DescriptionDasypus novemcinctus miR-19a stem-loop
Stem-loop
   --            --      ---    ag 
5'   aguuuugcauag  uugcac   uaca  a
     ||||||||||||  ||||||   ||||  a
3'   ucaaaacguauc  aacgug   augu  g
   ag            ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570327.1: 92615-92672 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-19a
dno-mir-17JH570327.1: 92325-92383 [+]
dno-mir-18aJH570327.1: 92464-92528 [+]
dno-mir-19aJH570327.1: 92615-92672 [+]
dno-mir-20aJH570327.1: 92793-92851 [+]
dno-mir-19b-1JH570327.1: 92928-92988 [+]
dno-mir-92a-1JH570327.1: 93045-93103 [+]
Database links

Mature sequence dno-miR-19a-5p

Accession MIMAT0047515
Sequence

1 - 

aguuuugcauaguugcacuac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-19a-3p

Accession MIMAT0047516
Sequence

36 - 

ugugcaaaucuaugcaaaacuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).