Stem-loop sequence dno-mir-18a

AccessionMI0038910 (change log)
DescriptionDasypus novemcinctus miR-18a stem-loop
Stem-loop
   ----u    u   uc   u    a   -  aa u 
5'      aagg gca  uag gcag uag ug  g a
        |||| |||  ||| |||| ||| ||  | g
3'      uucc cgu  auc cguc auc ac  u a
   cgguc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH570327.1: 92464-92528 [+]
intergenic
Clustered miRNAs
< 10kb from dno-mir-18a
dno-mir-17JH570327.1: 92325-92383 [+]
dno-mir-18aJH570327.1: 92464-92528 [+]
dno-mir-19aJH570327.1: 92615-92672 [+]
dno-mir-20aJH570327.1: 92793-92851 [+]
dno-mir-19b-1JH570327.1: 92928-92988 [+]
dno-mir-92a-1JH570327.1: 93045-93103 [+]
Database links

Mature sequence dno-miR-18a-5p

Accession MIMAT0047511
Sequence

1 - 

uaaggugcaucuagugcagauag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-miR-18a-3p

Accession MIMAT0047512
Sequence

42 - 

acugcccuaagugcuccuucuggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).