Stem-loop sequence dno-let-7c-2

AccessionMI0038887 (change log)
DescriptionDasypus novemcinctus let-7c-2 stem-loop
Stem-loop
   --u   g   u             uagaa ua a 
5'    gag uag agguuguaugguu     u  c u
      ||| ||| |||||||||||||     |  | c
3'    uuc auc uccgacaugucaa     a  g a
   ccu   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dasNov3.0; GCA_000208655.2) Overlapping transcripts
JH568225.1: 2292916-2292982 [-]
intergenic
Clustered miRNAs
< 10kb from dno-let-7c-2
dno-mir-100JH568225.1: 2298254-2298310 [-]
dno-let-7c-2JH568225.1: 2292916-2292982 [-]
Database links

Mature sequence dno-let-7c-5p

Accession MIMAT0047475
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dno-let-7c-2-3p

Accession MIMAT0047476
Sequence

46 - 

cuguacagccuccuagcuuucc

 - 67

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).