Stem-loop sequence cpo-mir-12084

AccessionMI0038885 (change log)
DescriptionCavia porcellus miR-12084 stem-loop
Stem-loop
   --a  c    ug       -    gauccu 
5'    gc uggg  acagccg gacg      g
      || ||||  ||||||| ||||      c
3'    cg accc  ugucggc cugc      g
   uug  a    gu       g    aaucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562920.1: 1244778-1244837 [+]
intergenic
Database links

Mature sequence cpo-miR-12084-5p

Accession MIMAT0047471
Sequence

1 - 

agccugggugacagccggacg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12084-3p

Accession MIMAT0047472
Sequence

39 - 

ucgcggcuguugcccaagcguu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).