Stem-loop sequence cpo-mir-12083

AccessionMI0038884 (change log)
DescriptionCavia porcellus miR-12083 stem-loop
Stem-loop
   --u         u   -     a   cua 
5'    uucugugug uca augga gcg   c
      ||||||||| ||| ||||| |||    
3'    aggacacgc agu uaccu ugu   c
   cuu         u   c     a   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562964.1: 302769-302825 [-]
intergenic
Database links

Mature sequence cpo-miR-12083-5p

Accession MIMAT0047469
Sequence

1 - 

uuucuguguguucaauggaagc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12083-3p

Accession MIMAT0047470
Sequence

35 - 

auccaucugaucgcacaggauuc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).