Stem-loop sequence cpo-mir-12082

AccessionMI0038883 (change log)
DescriptionCavia porcellus miR-12082 stem-loop
Stem-loop
   --    c   cac        -    aa   u 
5'   aagc aac   agacacca caga  aga a
     |||| |||   |||||||| ||||  |||  
3'   uucg uug   ucuguggu gucu  ucu a
   cu    -   -au        a    -c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562862.1: 45795923-45795982 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-12082
cpo-mir-12082DS562862.1: 45795923-45795982 [+]
cpo-mir-138-1DS562862.1: 45796470-45796530 [+]
Database links

Mature sequence cpo-miR-12082-5p

Accession MIMAT0047467
Sequence

1 - 

aagccaaccacagacaccacaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12082-3p

Accession MIMAT0047468
Sequence

39 - 

ugauggugucuuaguugcuuuc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).