Stem-loop sequence cpo-mir-12081

AccessionMI0038882 (change log)
DescriptionCavia porcellus miR-12081 stem-loop
Stem-loop
   --gg      g            --g  au 
5'     gccagg auuuagcucacu   gc  a
       |||||| ||||||||||||   ||  a
3'     cggucc uaaaucgaguga   cg  g
   cgaa      g            aua  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562880.1: 8798446-8798504 [-]
intergenic
Database links

Mature sequence cpo-miR-12081-5p

Accession MIMAT0047465
Sequence

1 - 

gggccagggauuuagcucacu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12081-3p

Accession MIMAT0047466
Sequence

39 - 

ugagcuaaaugccuggcaagc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).