Stem-loop sequence cpo-mir-12079

AccessionMI0038880 (change log)
DescriptionCavia porcellus miR-12079 stem-loop
Stem-loop
   --ca       ug a    c  - u -    g 
5'     cacucuc  a ccca ug c c aucu c
       |||||||  | |||| || | | ||||  
3'     gugagag  u gggu ac g g uaga a
   ucca       gu a    -  a u c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562880.1: 8963913-8963973 [-]
intergenic
Database links

Mature sequence cpo-miR-12079-5p

Accession MIMAT0047461
Sequence

1 - 

cacacucucugaacccacugcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12079-3p

Accession MIMAT0047462
Sequence

40 - 

acaugggauuggagagugaccu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).