Stem-loop sequence cpo-mir-526

AccessionMI0038879 (change log)
DescriptionCavia porcellus miR-526 stem-loop
Stem-loop
   --c      c   -aa         gugu 
5'    cucgag gag   gcacuuucu    a
      |||||| |||   |||||||||    a
3'    gagcuc cuc   cgugaaggg    a
   ugc      u   cug         aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562925.1: 3095374-3095431 [-]
intergenic
Database links

Mature sequence cpo-miR-526-5p

Accession MIMAT0047459
Sequence

1 - 

ccucgagcgagaagcacuuucu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-526-3p

Accession MIMAT0047460
Sequence

36 - 

gaagugcguccucucucgagcgu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).