Stem-loop sequence cpo-mir-12078

AccessionMI0038878 (change log)
DescriptionCavia porcellus miR-12078 stem-loop
Stem-loop
   --   --    -     u         cuca  uuc 
5'   agg  ugga acucu gauagucug    cu   a
     |||  |||| ||||| |||||||||    ||    
3'   ucc  accu ugaga cuaucagac    ga   c
   ug   uu    c     -         --uc  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562896.1: 4308585-4308650 [+]
intergenic
Database links

Mature sequence cpo-miR-12078-5p

Accession MIMAT0047457
Sequence

1 - 

agguggaacucuugauagucu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12078-3p

Accession MIMAT0047458
Sequence

44 - 

acuaucagagucuccauuccugu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).