Stem-loop sequence cpo-mir-12077

AccessionMI0038877 (change log)
DescriptionCavia porcellus miR-12077 stem-loop
Stem-loop
   --          u  g        u  g 
5'   ugcucagagu gc ucgguuac ua a
     |||||||||| || |||||||| || g
3'   augggucuca cg agucaaug au u
   ag          c  g        c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 3933561-3933617 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-12077
cpo-mir-892DS562939.1: 3931986-3932054 [+]
cpo-mir-12077DS562939.1: 3933561-3933617 [+]
Database links

Mature sequence cpo-miR-12077-5p

Accession MIMAT0047455
Sequence

1 - 

ugcucagaguugcgucgguuac

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12077-3p

Accession MIMAT0047456
Sequence

36 - 

aacugaggccacucuggguaga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).