Stem-loop sequence cpo-mir-12076

AccessionMI0038876 (change log)
DescriptionCavia porcellus miR-12076 stem-loop
Stem-loop
   ---c    c c     u      cucug  u 
5'     cugg c ggcag guuugg     uc g
       |||| | ||||| ||||||     || u
3'     gacc g ccguc cgaacu     ag g
   ggga    a u     u      --cca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562858.1: 1597129-1597188 [+]
intergenic
Database links

Mature sequence cpo-miR-12076-5p

Accession MIMAT0047453
Sequence

1 - 

ccuggcccggcaguguuuggc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12076-3p

Accession MIMAT0047454
Sequence

39 - 

caagcucugccugaccagaggg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).