Stem-loop sequence cpo-mir-12075

AccessionMI0038875 (change log)
DescriptionCavia porcellus miR-12075 stem-loop
Stem-loop
   uu      aca   c     uu         ugugua 
5'   uauuac   acu cagga  cgucgauca      a
     ||||||   ||| |||||  |||||||||       
3'   auaaug   uga guccu  gcggcuagu      u
   ac      aag   a     cu         uugaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2702877-2702952 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-12075
cpo-mir-506DS562939.1: 2699627-2699683 [+]
cpo-mir-12075DS562939.1: 2702877-2702952 [+]
Database links

Mature sequence cpo-miR-12075-5p

Accession MIMAT0047451
Sequence

10 - 

caacuccaggauucgucgauca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12075-3p

Accession MIMAT0047452
Sequence

48 - 

aucggcgucuccugaagugaag

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).