Stem-loop sequence cpo-mir-12074

AccessionMI0038874 (change log)
DescriptionCavia porcellus miR-12074 stem-loop
Stem-loop
   --          u      g   a   - ug 
5'   ucugaaaucu aaacuu uug gug c  a
     |||||||||| |||||| ||| ||| |   
3'   agauuuuaga uuugaa gac cac g  c
   cg          c      -   c   a ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562998.1: 1245387-1245446 [+]
intergenic
Database links

Mature sequence cpo-miR-12074-5p

Accession MIMAT0047449
Sequence

1 - 

ucugaaaucuuaaacuuguugagu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12074-3p

Accession MIMAT0047450
Sequence

38 - 

ccagaaguuucagauuuuagagc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).