Stem-loop sequence cpo-mir-12073

AccessionMI0038873 (change log)
DescriptionCavia porcellus miR-12073 stem-loop
Stem-loop
   --uu      c  u          cgggggcaacccc 
5'     cagagu gc ugucucaucc             u
       |||||| || ||||||||||              
3'     gucuca cg gcaggguagg             u
   cuuu      a  c          acaagaaucggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 952329-952402 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-12073
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
cpo-mir-12073DS562966.1: 952329-952402 [+]
cpo-mir-433DS562966.1: 952524-952597 [+]
cpo-mir-127DS562966.1: 953628-953683 [+]
cpo-mir-432DS562966.1: 955129-955197 [+]
cpo-mir-136DS562966.1: 955349-955404 [+]
Database links

Mature sequence cpo-miR-12073-5p

Accession MIMAT0047447
Sequence

1 - 

uucagagucgcuugucucaucc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12073-3p

Accession MIMAT0047448
Sequence

53 - 

augggacgcgcaacucuguuuc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).