Stem-loop sequence cpo-mir-12072

AccessionMI0038872 (change log)
DescriptionCavia porcellus miR-12072 stem-loop
Stem-loop
   --   g     - uug   ga    --   u 
5'   ugg cugcc c   ccu  cucu  guc c
     ||| ||||| |   |||  ||||  ||| a
3'   acc gacgg g   gga  gagg  uag c
   ga   g     a -ua   aa    ag   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562872.1: 14952640-14952698 [-]
intergenic
Database links

Mature sequence cpo-miR-12072-5p

Accession MIMAT0047445
Sequence

1 - 

ugggcugcccuugccugacucu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-12072-3p

Accession MIMAT0047446
Sequence

38 - 

agaaaggaugaggcaggccaag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).