Stem-loop sequence cpo-mir-6529

AccessionMI0038871 (change log)
DescriptionCavia porcellus miR-6529 stem-loop
Stem-loop
   ---     auc          a  acgucac 
5'    gagag   agaggcgcag gu       u
      |||||   |||||||||| ||       g
3'    uucuc   uuuccguguc cg       u
   aau     cau          -  aaauaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562890.1: 21457209-21457269 [-]
intergenic
Database links

Mature sequence cpo-miR-6529-5p

Accession MIMAT0047443
Sequence

1 - 

gagagaucagaggcgcagagu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-6529-3p

Accession MIMAT0047444
Sequence

40 - 

ccugugccuuuuaccucuuuaa

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).