Stem-loop sequence cpo-mir-3959

AccessionMI0038870 (change log)
DescriptionCavia porcellus miR-3959 stem-loop
Stem-loop
   --g  u      -a  a        uua 
5'    gu gaucag  ga cauacauu   c
      || ||||||  || ||||||||    
3'    ca cuaguc  cu guauguag   c
   uga  c      ag  -        uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1104334-1104387 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-3959
cpo-mir-376cDS562966.1: 1095062-1095119 [+]
cpo-mir-376dDS562966.1: 1095388-1095445 [+]
cpo-mir-654DS562966.1: 1095544-1095600 [+]
cpo-mir-376bDS562966.1: 1095759-1095816 [+]
cpo-mir-376aDS562966.1: 1096085-1096142 [+]
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
cpo-mir-382DS562966.1: 1107038-1107096 [+]
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
Database links

Mature sequence cpo-miR-3959-5p

Accession MIMAT0047441
Sequence

1 - 

gguugaucagagaacauacauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-3959-3p

Accession MIMAT0047442
Sequence

33 - 

uguaugucgacugauccacagu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).