Stem-loop sequence cpo-mir-3613

AccessionMI0038869 (change log)
DescriptionCavia porcellus miR-3613 stem-loop
Stem-loop
   --u    ua               g   c 
5'    guug  cuuuuuuuuuuguuc uug a
      ||||  ||||||||||||||| ||| u
3'    caac  ggaaaaaaaaacaag aau u
   ucc    -c               g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562861.1: 59835890-59835947 [-]
intergenic
Database links

Mature sequence cpo-miR-3613-5p

Accession MIMAT0047439
Sequence

1 - 

uguuguacuuuuuuuuuuguuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-3613-3p

Accession MIMAT0047440
Sequence

38 - 

acaaaaaaaaaggccaacccu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).