Stem-loop sequence cpo-mir-513

AccessionMI0038868 (change log)
DescriptionCavia porcellus miR-513 stem-loop
Stem-loop
   --   a                    gua 
5'   uuc caagaaagugucauucaugu   c
     ||| ||||||||||||||||||||    
3'   aag guucuuuuacggugaguaua   u
   ag   c                    aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562939.1: 2797729-2797786 [+]
intergenic
Database links

Mature sequence cpo-miR-513-5p

Accession MIMAT0047437
Sequence

1 - 

uucacaagaaagugucauucaug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-513-3p

Accession MIMAT0047438
Sequence

36 - 

ugaguggcauuuucuugcgaaga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).