Stem-loop sequence cpo-mir-3085

AccessionMI0038867 (change log)
DescriptionCavia porcellus miR-3085 stem-loop
Stem-loop
   -   c     ucu ag      g   uu   u 
5'  agg gccau   g  ggccag agu  gau a
    ||| |||||   |  |||||| |||  ||| u
3'  ucc cggua   c  ucgguc uca  cug g
   c   c     --u -g      -   --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562856.1: 31517490-31517549 [-]
intergenic
Database links

Mature sequence cpo-miR-3085-5p

Accession MIMAT0047435
Sequence

1 - 

aggcgccauucugagggccaggagu

 - 25

Get sequence
Evidence not experimental

Mature sequence cpo-miR-3085-3p

Accession MIMAT0047436
Sequence

41 - 

ucuggcugcuauggccccuc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).